Online Inquiry
CDC42BPB Knockout Cell Line
SPL-00877
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 11bp deletion |
| Target Information | |
|---|---|
| Target Name | CDC42BPB |
| Gene Abbr. | CDC42BPB |
| Gene ID | 9578 |
| Full Name | CDC42 binding protein kinase beta |
| Alias | MRCKB |
| Species | Human |
| Genomic Locus | chr14:102986531 |
| Transcript | NM_006035 |
| WT Expression Level | 29.73 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the serine/threonine protein kinase family. The encoded protein contains a Cdc42/Rac-binding p21 binding domain resembling that of PAK kinase. The kinase domain of this protein is most closely related to that of myotonic dystrophy kinase-related ROK. Studies of the similar gene in rat suggested that this kinase may act as a downstream effector of Cdc42 in cytoskeletal reorganization. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 11bp deletion in a coding exon of CDC42BPB. |
| Description | 11bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CGTGAATGGTCATATCCGCC |
| PCR Primer |
Forward: ACTCCCCAAACAGAAAATTTCAACT Reverse: ATCACCACTAGTTAAGGGCTTTGAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.