CDC37 cDNA ORF Clone, Human, C-Myc tag - CD BioSciences

service-banner

CDC37 cDNA ORF Clone, Human, C-Myc tag

CDC37 cDNA ORF Clone, Human, C-Myc tag

SPD-03155

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human cell division cycle 37 homolog (S. cerevisiae) with C terminal Myc tag.
Target Information
Species Human
Target Name Cdc37
Gene Abbr. CDC37
Gene ID 11140
Full Name cell division cycle 37, HSP90 cochaperone
Alias P50CDC37
Introduction CDC37 is an important component of the HSP90 chaperone complex. It was initially identified for its involvement in cell-cycle progression and was later found to have a much broader role as a chaperone for a wide variety of kinases and other proteins. CDC37 protein has an amino-terminal kinase binding domain followed by a central HSP90 binding domain. It recruits and stabilizes kinases in the HSP90 complex by protecting the newly synthesized kinase peptide chain from degradation and promoting the next step of protein maturation. CDC37 also suppresses the ATPase activity of HSP90, thereby leading to conformational changes in the complex that preclude target kinase loading. CDC37 has been proposed as a therapeutic target because of its important role in multiple kinase pathways involved in proliferation and cancer cell survival, including Raf, Akt, Src, and ErbB2 pathways.
Product Details
Description Full length Clone DNA of Human cell division cycle 37 homolog (S. cerevisiae) with C terminal Myc tag.
NCBI Ref Seq NM_007065.3
RefSeq ORF Size 1137 bp
Vector pCMV3-C-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.