Online Inquiry
CDC37 cDNA ORF Clone, Human, C-Myc tag
SPD-03155
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human cell division cycle 37 homolog (S. cerevisiae) with C terminal Myc tag. |
Target Information | |
---|---|
Species | Human |
Target Name | Cdc37 |
Gene Abbr. | CDC37 |
Gene ID | 11140 |
Full Name | cell division cycle 37, HSP90 cochaperone |
Alias | P50CDC37 |
Introduction | CDC37 is an important component of the HSP90 chaperone complex. It was initially identified for its involvement in cell-cycle progression and was later found to have a much broader role as a chaperone for a wide variety of kinases and other proteins. CDC37 protein has an amino-terminal kinase binding domain followed by a central HSP90 binding domain. It recruits and stabilizes kinases in the HSP90 complex by protecting the newly synthesized kinase peptide chain from degradation and promoting the next step of protein maturation. CDC37 also suppresses the ATPase activity of HSP90, thereby leading to conformational changes in the complex that preclude target kinase loading. CDC37 has been proposed as a therapeutic target because of its important role in multiple kinase pathways involved in proliferation and cancer cell survival, including Raf, Akt, Src, and ErbB2 pathways. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human cell division cycle 37 homolog (S. cerevisiae) with C terminal Myc tag. |
NCBI Ref Seq | NM_007065.3 |
RefSeq ORF Size | 1137 bp |
Vector | pCMV3-C-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.