Online Inquiry
CDC25C Knockout Cell Line
SPL-00875
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 35bp deletion |
| Target Information | |
|---|---|
| Target Name | Cdc25C |
| Gene Abbr. | CDC25C |
| Gene ID | 995 |
| Full Name | cell division cycle 25C |
| Alias | CDC25, PPP1R60 |
| Species | Human |
| Genomic Locus | chr5:138331046 |
| Transcript | NM_001790 |
| WT Expression Level | 33.10 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a conserved protein that plays a key role in the regulation of cell division. The encoded protein directs dephosphorylation of cyclin B-bound CDC2 and triggers entry into mitosis. It also suppresses p53-induced growth arrest. Multiple alternatively spliced transcript variants of this gene have been described. [provided by RefSeq, Dec 2015]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 35bp deletion in a coding exon of CDC25C. |
| Description | 35bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GACATCTGGACAGACGGTAA |
| PCR Primer |
Forward: GACTCAAAAGGGTTACACAGTCAAG Reverse: TTTTCTCCTGGTGAGAATTCGAAGA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.