CDC25C cDNA ORF Clone, Human, C-His tag - CD BioSciences

service-banner

CDC25C cDNA ORF Clone, Human, C-His tag

CDC25C cDNA ORF Clone, Human, C-His tag

SPD-03134

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human cell division cycle 25 homolog C (S. pombe) with C terminal His tag.
Target Information
Species Human
Target Name Cdc25C
Gene Abbr. CDC25C
Gene ID 995
Full Name cell division cycle 25C
Alias CDC25, PPP1R60
Introduction Cdc25 is a protein phosphatase responsible for dephosphorylating and activating cdc2, a crucial step in regulating the entry of all eukaryotic cells into mitosis. cdc25C is constitutively phosphorylated at Ser216 throughout interphase by c-TAK1, while phosphorylation at this site is DNA damage-dependent at the G2/M checkpoint. When phosphorylated at Ser216, cdc25C binds to members of the 14-3-3 family of proteins, sequestering cdc25C in the cytoplasm and thereby preventing premature mitosis. The checkpoint kinases Chk1 and Chk2 phosphorylate cdc25C at Ser216 in response to DNA damage.
Product Details
Description Full length Clone DNA of Human cell division cycle 25 homolog C (S. pombe) with C terminal His tag.
NCBI Ref Seq BC019089
RefSeq ORF Size 1422 bp
Vector pCMV3-C-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.