Online Inquiry
CDC25C cDNA ORF Clone, Human, C-FLAG tag
SPD-03133
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human cell division cycle 25 homolog C (S. pombe) with C terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | Cdc25C |
Gene Abbr. | CDC25C |
Gene ID | 995 |
Full Name | cell division cycle 25C |
Alias | CDC25, PPP1R60 |
Introduction | Cdc25 is a protein phosphatase responsible for dephosphorylating and activating cdc2, a crucial step in regulating the entry of all eukaryotic cells into mitosis. cdc25C is constitutively phosphorylated at Ser216 throughout interphase by c-TAK1, while phosphorylation at this site is DNA damage-dependent at the G2/M checkpoint. When phosphorylated at Ser216, cdc25C binds to members of the 14-3-3 family of proteins, sequestering cdc25C in the cytoplasm and thereby preventing premature mitosis. The checkpoint kinases Chk1 and Chk2 phosphorylate cdc25C at Ser216 in response to DNA damage. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human cell division cycle 25 homolog C (S. pombe) with C terminal Flag tag. |
NCBI Ref Seq | BC019089 |
RefSeq ORF Size | 1422 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-C-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Restriction Sites | KpnI + XbaI (6kb + 1.47kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.