Online Inquiry
CDC25A cDNA ORF Clone, Human, N-FLAG tag
SPD-03108
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human cell division cycle 25 homolog A (S. pombe) with N terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | Cdc25A |
Gene Abbr. | CDC25A |
Gene ID | 993 |
Full Name | cell division cycle 25A |
Alias | CDC25A2 |
Introduction | The cdc25 protein phosphatase family plays a critical role in activating cyclin-dependent kinases (CDKs) via dephosphorylation of conserved Thr14/Tyr15 inhibitory phosphorylation sites. While cdc25C is primarily responsible for activating CDK1 to overcome the G2/M checkpoint and allow mitotic entry, the primary substrate of cdc25A is CDK2, which, when active, allows progression through the G1/S and intra-S checkpoints. Abundance, subcellular localization and activity of cdc25A is tightly controlled by a variety of mechanisms, including phosphorylation, ubiquitination, and inhibitory binding to 14-3-3 proteins. During normal cell cycle progression, elevated c-Myc and E2F transcription factor levels lead to increased cdc25A expression. When conditions are favorable for DNA synthesis, cdc25A and CDK2 form an activation loop, wherein each activates the other enzyme. DNA damage, on the other hand, leads to multisite phosphorylation at inhibitory sites (Ser123, Ser177, Ser278, Ser292, and Thr506) by Chk1 and Chk2, which result in 14-3-3 binding and ubiquitin-mediated degradation. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human cell division cycle 25 homolog A (S. pombe) with N terminal Flag tag. |
NCBI Ref Seq | NM_001789.2 |
RefSeq ORF Size | 1575 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-N-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Restriction Sites | KpnI + NotI (6kb + 1.61kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.