CDC25A cDNA ORF Clone, Human, C-FLAG tag - CD BioSciences

service-banner

CDC25A cDNA ORF Clone, Human, C-FLAG tag

CDC25A cDNA ORF Clone, Human, C-FLAG tag

SPD-03103

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human cell division cycle 25 homolog A (S. pombe) with C terminal Flag tag.
Target Information
Species Human
Target Name Cdc25A
Gene Abbr. CDC25A
Gene ID 993
Full Name cell division cycle 25A
Alias CDC25A2
Introduction The cdc25 protein phosphatase family plays a critical role in activating cyclin-dependent kinases (CDKs) via dephosphorylation of conserved Thr14/Tyr15 inhibitory phosphorylation sites. While cdc25C is primarily responsible for activating CDK1 to overcome the G2/M checkpoint and allow mitotic entry, the primary substrate of cdc25A is CDK2, which, when active, allows progression through the G1/S and intra-S checkpoints. Abundance, subcellular localization and activity of cdc25A is tightly controlled by a variety of mechanisms, including phosphorylation, ubiquitination, and inhibitory binding to 14-3-3 proteins. During normal cell cycle progression, elevated c-Myc and E2F transcription factor levels lead to increased cdc25A expression. When conditions are favorable for DNA synthesis, cdc25A and CDK2 form an activation loop, wherein each activates the other enzyme. DNA damage, on the other hand, leads to multisite phosphorylation at inhibitory sites (Ser123, Ser177, Ser278, Ser292, and Thr506) by Chk1 and Chk2, which result in 14-3-3 binding and ubiquitin-mediated degradation.
Product Details
Description Full length Clone DNA of Human cell division cycle 25 homolog A (S. pombe) with C terminal Flag tag.
NCBI Ref Seq NM_001789.2
RefSeq ORF Size 1575 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + NotI (6kb + 1.61kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.