CD70 cDNA ORF Clone, Rhesus, untagged - CD BioSciences

service-banner

CD70 cDNA ORF Clone, Rhesus, untagged

CD70 cDNA ORF Clone, Rhesus, untagged

SPD-02699

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rhesus CD70 molecule.
Target Information
Species Rhesus
Target Name CD27 Ligand
Gene Abbr. CD70
Gene ID 701080
Full Name CD70 molecule
Introduction CD27 Ligand is a member of the tumor necrosis factor superfamily (TNFSF7) and is also designated CD70. CD27 Ligand is a type II transmembrane protein expressed by activated T and B cells. It binds to CD27 on mature T cells and a subset of thymocytes. CD27 Ligand induces the proliferation of costimulated T cells and enhances the generation of cytolytic T cells.
Product Details
Description Full length Clone DNA of Rhesus CD70 molecule.
NCBI Ref Seq XM_001088935.2
RefSeq ORF Size 585 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 0.59kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.