Online Inquiry
CD70 cDNA ORF Clone, Rhesus, C-FLAG tag
SPD-02690
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Rhesus CD70 molecule with C terminal Flag tag. |
Target Information | |
---|---|
Species | Rhesus |
Target Name | CD27 Ligand |
Gene Abbr. | CD70 |
Gene ID | 701080 |
Full Name | CD70 molecule |
Introduction | CD27 Ligand is a member of the tumor necrosis factor superfamily (TNFSF7) and is also designated CD70. CD27 Ligand is a type II transmembrane protein expressed by activated T and B cells. It binds to CD27 on mature T cells and a subset of thymocytes. CD27 Ligand induces the proliferation of costimulated T cells and enhances the generation of cytolytic T cells. |
Product Details | |
---|---|
Description | Full length Clone DNA of Rhesus CD70 molecule with C terminal Flag tag. |
NCBI Ref Seq | XM_001088935.2 |
RefSeq ORF Size | 585 bp |
Vector | pCMV3-C-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.