Online Inquiry
CD59 Knockout Cell Line
SPL-00868
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 20bp deletion |
| Target Information | |
|---|---|
| Target Name | CD59 |
| Gene Abbr. | CD59 |
| Gene ID | 966 |
| Full Name | CD59 molecule (CD59 blood group) |
| Alias | 16.3A5, 1F5, EJ16, EJ30, EL32 |
| Species | Human |
| Genomic Locus | chr11:33722400 |
| Transcript | NM_000611 |
| WT Expression Level | 139.65 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a cell surface glycoprotein that regulates complement-mediated cell lysis, and it is involved in lymphocyte signal transduction. This protein is a potent inhibitor of the complement membrane attack complex, whereby it binds complement C8 and/or C9 during the assembly of this complex, thereby inhibiting the incorporation of multiple copies of C9 into the complex, which is necessary for osmolytic pore formation. This protein also plays a role in signal transduction pathways in the activation of T cells. Mutations in this gene cause CD59 deficiency, a disease resulting in hemolytic anemia and thrombosis, and which causes cerebral infarction. Multiple alternatively spliced transcript variants, which encode the same protein, have been identified for this gene. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 20bp deletion in a coding exon of CD59. |
| Description | 20bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GTTCGGGCTGCTGCTCGTCC |
| PCR Primer |
Forward: CCACTGAGGACAAGGTCATAACATA Reverse: TTTTTGAGACAACCAGCAGTCATTT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.