Cd55 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Cd55 cDNA ORF Clone, Mouse, untagged

Cd55 cDNA ORF Clone, Mouse, untagged

SPD-03072

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse CD55 antigen.
Target Information
Species Mouse
Target Name CD55
Gene Abbr. Cd55
Gene ID 13136
Full Name CD55 molecule, decay accelerating factor for complement
Alias Daf, Daf-, Daf-GPI, Daf1, GPI-
Product Details
Description Full length Clone DNA of Mouse CD55 antigen.
NCBI Ref Seq NM_010016.2
RefSeq ORF Size 1173 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 1.17kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.