Cd46 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Cd46 cDNA ORF Clone, Mouse, untagged

Cd46 cDNA ORF Clone, Mouse, untagged

SPD-03042

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse CD46 antigen, complement regulatory protein.
Target Information
Species Mouse
Target Name CD46
Gene Abbr. Cd46
Gene ID 17221
Full Name CD46 antigen, complement regulatory protein
Alias Mc, Mcp
Product Details
Description Full length Clone DNA of Mouse CD46 antigen, complement regulatory protein.
NCBI Ref Seq NM_010778.3
RefSeq ORF Size 1098 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 1.1kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.