Online Inquiry
CD40LG cDNA ORF Clone, Rhesus, C-Myc tag
SPD-02986
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Rhesus CD40 ligand with C terminal Myc tag. |
| Target Information | |
|---|---|
| Species | Rhesus |
| Target Name | CD40 Ligand |
| Gene Abbr. | CD40LG |
| Gene ID | 574160 |
| Full Name | CD40 ligand |
| Introduction | CD40 ligand, CD40L (also known as CD154, TRAP or gp39), is a 261 amino acid type II transmembrane glycoprotein belonging to the TNF family, CD40L is expressed predominantly on activated CD4+ T lymphocytes, and also found in other types of cells, like NK cells, mast cells, basophils and eosinophils. Human CD40L shares 78% amino acid identity with its murine counterpart. The receptor of CD40L is CD40, a type I transmembrane glycoprotein belonging to the TNF receptor family. CD40 is expressed on B lymphocytes, monocytes, dendritic cells and thymic epithelium. Although all monomeric, dimeric and trimeric forms of soluble CD40L can bind to CD40, the trimeric form of soluble CD40L has the most potent biological activity through oligomerization of cell surface CD40, a common feature of TNF receptor family members. CD40L mediates a range of activities on B cells including induction of activation-associated surface antigen, entry into cell cycle, isotype switching and Ig secretion and memory generation. CD40-CD40L interaction also plays important roles in monocyte activation and dendritic cell maturation. Armitage, R.J. et al. (1992) Nature 357:80. Hollenbaugh, D. et al. (1992) EMBO J. 11:4313. Spriggs, M.K. et al. (1992) J. Exp. Med. 176:1543. Fanslow, W.C. et al. (1994) Seminars in Immunology 6:267. Kooten, C.V. and J. Banchereau (2000) J. Leukoc. Biol. 67:2. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Rhesus CD40 ligand with C terminal Myc tag. |
| NCBI Ref Seq | NM_001032839.1 |
| RefSeq ORF Size | 786 bp |
| Vector | pCMV3-C-Myc |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.