Online Inquiry
CD40 cDNA ORF Clone, Rhesus, C-HA tag
SPD-02953
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Rhesus CD40 molecule, TNF receptor superfamily member 5 with C terminal HA tag. |
Target Information | |
---|---|
Species | Rhesus |
Target Name | CD40 |
Gene Abbr. | CD40 |
Gene ID | 707749 |
Full Name | CD40 molecule |
Introduction | CD40 is a costimulatory molecule of the TNF receptor superfamily and is expressed on many cell types, such as B cells, monocytes/macrophages, dendritic cells, endothelial cells, fibroblasts or vascular smooth muscle cells. Interaction of CD40 and its ligand CD154 (CD40L) is required for the generation of antibody responses to T-dependent antigens as well as for the development of germinal centers and memory B cells. In monocytes/macrophages CD40 engagement induces production of pro-inflammatory cytokines and chemokines. CD40-CD154 interactions are also critical for development of CD4 T cell-dependent effector functions. CD40 links innate and adaptive immune responses to bacterial stimuli and serves as an important regulator affecting functions of other costimulatory molecules. |
Product Details | |
---|---|
Description | Full length Clone DNA of Rhesus CD40 molecule, TNF receptor superfamily member 5 with C terminal HA tag. |
NCBI Ref Seq | XM_001104333.2 |
RefSeq ORF Size | 837 bp |
Vector | pCMV3-C-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.