CD40 cDNA ORF Clone, Human, N-Myc tag - CD BioSciences

service-banner

CD40 cDNA ORF Clone, Human, N-Myc tag

CD40 cDNA ORF Clone, Human, N-Myc tag

SPD-02981

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human CD40 molecule, TNF receptor superfamily member 5 with N terminal Myc tag.
Target Information
Species Human
Target Name CD40
Gene Abbr. CD40
Gene ID 958
Full Name CD40 molecule
Alias Bp50, CDW40, TNFRSF5, p50
Introduction CD40 is a costimulatory molecule of the TNF receptor superfamily and is expressed on many cell types, such as B cells, monocytes/macrophages, dendritic cells, endothelial cells, fibroblasts or vascular smooth muscle cells. Interaction of CD40 and its ligand CD154 (CD40L) is required for the generation of antibody responses to T-dependent antigens as well as for the development of germinal centers and memory B cells. In monocytes/macrophages CD40 engagement induces production of pro-inflammatory cytokines and chemokines. CD40-CD154 interactions are also critical for development of CD4 T cell-dependent effector functions. CD40 links innate and adaptive immune responses to bacterial stimuli and serves as an important regulator affecting functions of other costimulatory molecules.
Product Details
Description Full length Clone DNA of Human CD40 molecule, TNF receptor superfamily member 5 with N terminal Myc tag.
NCBI Ref Seq NM_001250.4
RefSeq ORF Size 867 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-SP-N-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Restriction Sites KpnI + XbaI (6kb + 0.87kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.