CD4 cDNA ORF Clone, Rhesus, N-His tag - CD BioSciences

service-banner

CD4 cDNA ORF Clone, Rhesus, N-His tag

CD4 cDNA ORF Clone, Rhesus, N-His tag

SPD-02906

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rhesus CD40 ligand with N terminal His tag.
Target Information
Species Rhesus
Target Name CD4
Gene Abbr. CD4
Gene ID 713807
Full Name CD4 molecule
Introduction Cluster of Differentiation 4 (CD4) is a glycoprotein composed of an amino-terminal extracellular domain (four domains: D1-D4 with Ig-like structures), a transmembrane part, and a short cytoplasmic tail. CD4 is expressed on the surface of T helper cells, regulatory T cells, monocytes, macrophages, and dendritic cells, and plays an important role in the development and activation of T cells. On T cells, CD4 is the co-receptor for the T cell receptor (TCR), and these two distinct structures recognize the Antigen–Major Histocompatibility Complex (MHC). Specifically, the D1 domain of CD4 interacts with the β2-domain of the MHC class II molecule. CD4 ensures specificity of the TCR–antigen interaction, prolongs the contact between the T cell and the antigen presenting cell, and recruits the tyrosine kinase Lck, which is essential for T cell activation.
Product Details
Description Full length Clone DNA of Rhesus CD40 ligand with N terminal His tag.
NCBI Ref Seq NM_001042662.1
RefSeq ORF Size 1377 bp
Vector pCMV3-SP-N-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.