Online Inquiry
Cd4 cDNA ORF Clone, Rat, N-FLAG tag
SPD-02915
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Rat Cd4 molecule with N terminal Flag tag. |
Target Information | |
---|---|
Species | Rat |
Target Name | CD4 |
Gene Abbr. | Cd4 |
Gene ID | 24932 |
Full Name | Cd4 molecule |
Alias | W3/25, p55 |
Introduction | Cluster of Differentiation 4 (CD4) is a glycoprotein composed of an amino-terminal extracellular domain (four domains: D1-D4 with Ig-like structures), a transmembrane part, and a short cytoplasmic tail. CD4 is expressed on the surface of T helper cells, regulatory T cells, monocytes, macrophages, and dendritic cells, and plays an important role in the development and activation of T cells. On T cells, CD4 is the co-receptor for the T cell receptor (TCR), and these two distinct structures recognize the Antigen–Major Histocompatibility Complex (MHC). Specifically, the D1 domain of CD4 interacts with the β2-domain of the MHC class II molecule. CD4 ensures specificity of the TCR–antigen interaction, prolongs the contact between the T cell and the antigen presenting cell, and recruits the tyrosine kinase Lck, which is essential for T cell activation. |
Product Details | |
---|---|
Description | Full length Clone DNA of Rat Cd4 molecule with N terminal Flag tag. |
NCBI Ref Seq | NM_012705.1 |
RefSeq ORF Size | 1374 bp |
Vector | pCMV3-SP-N-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.