CD3D cDNA ORF Clone, Rhesus, untagged - CD BioSciences

service-banner

CD3D cDNA ORF Clone, Rhesus, untagged

CD3D cDNA ORF Clone, Rhesus, untagged

SPD-02779

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rhesus CD3d molecule, delta (CD3-TCR complex).
Target Information
Species Rhesus
Target Name CD3
Gene Abbr. CD3D
Gene ID 699582
Full Name CD3d molecule
Introduction When T cells encounter antigens via the T cell receptor (TCR), information about the quantity and quality of antigens is relayed to the intracellular signal transduction machinery. This activation process depends mainly on CD3 (Cluster of Differentiation 3), a multiunit protein complex that directly associates with the TCR. CD3 is composed of four polypeptides: ζ, γ, ε and δ. Each of these polypeptides contains at least one immunoreceptor tyrosine-based activation motif (ITAM). Engagement of TCR complex with foreign antigens induces tyrosine phosphorylation in the ITAM motifs and phosphorylated ITAMs function as docking sites for signaling molecules such as ZAP-70 and p85 subunit of PI-3 kinase. TCR ligation also induces a conformational change in CD3ε, such that a proline region is exposed and then associates with the adaptor protein Nck.The CD3ζ invariant chain is a type-I transmembrane protein that exists in the TCR signaling complex as a disulfide-linked homodimer.
Product Details
Description Full length Clone DNA of Rhesus CD3d molecule, delta (CD3-TCR complex).
NCBI Ref Seq XM_001097302.2
RefSeq ORF Size 516 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Please check the sequence information before order.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 0.52kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.