Online Inquiry
CD3D cDNA ORF Clone, Human, N-Myc tag
SPD-02858
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human CD3d molecule, delta (CD3-TCR complex) with N terminal Myc tag. |
Target Information | |
---|---|
Species | Human |
Target Name | CD3 |
Gene Abbr. | CD3D |
Gene ID | 915 |
Full Name | CD3d molecule |
Alias | CD3-DELTA, IMD19, T3D |
Introduction | When T cells encounter antigens via the T cell receptor (TCR), information about the quantity and quality of antigens is relayed to the intracellular signal transduction machinery. This activation process depends mainly on CD3 (Cluster of Differentiation 3), a multiunit protein complex that directly associates with the TCR. CD3 is composed of four polypeptides: ζ, γ, ε and δ. Each of these polypeptides contains at least one immunoreceptor tyrosine-based activation motif (ITAM). Engagement of TCR complex with foreign antigens induces tyrosine phosphorylation in the ITAM motifs and phosphorylated ITAMs function as docking sites for signaling molecules such as ZAP-70 and p85 subunit of PI-3 kinase. TCR ligation also induces a conformational change in CD3ε, such that a proline region is exposed and then associates with the adaptor protein Nck.The CD3ζ invariant chain is a type-I transmembrane protein that exists in the TCR signaling complex as a disulfide-linked homodimer. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human CD3d molecule, delta (CD3-TCR complex) with N terminal Myc tag. |
NCBI Ref Seq | NM_000732.4 |
RefSeq ORF Size | 516 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-SP-N-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Restriction Sites | KpnI + XbaI (6kb + 0.55kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.