Online Inquiry
CD2BP2 Knockout Cell Line
SPL-00851
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
8bp deletion |
Target Information | |
---|---|
Target Name | CD2BP2 |
Gene Abbr. | CD2BP2 |
Gene ID | 10421 |
Full Name | CD2 cytoplasmic tail binding protein 2 |
Alias | FWP010, LIN1, PPP1R59, Snu40, U5-52K |
Species | Human |
Genomic Locus | chr16:30354270 |
Transcript | NM_006110 |
WT Expression Level | 36.59 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a bi-functional protein. In the cytoplasm, the encoded protein binds the cytoplasmic tail of human surface antigen CD2 via its C-terminal GYF domain, and regulate CD2-triggered T lymphocyte activation. In the nucleus, this protein is a component of the U5 small nuclear ribonucleoprotein complex and is involved in RNA splicing. A pseudogene has been identified on chromosome 7. Alternative splicing results in multiple transcript variants but their biological validity has not been determined. [provided by RefSeq, Nov 2008]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 8bp deletion in a coding exon of CD2BP2. |
Description | 8bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | TTGCCTTTAAAGCGGCTCCC |
PCR Primer |
Forward: CTACTTGTTTTTCCAGCAGAGTGTA Reverse: GGGAAGTAGTCGAGATCCTGAAATA |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.