Online Inquiry
Cd28 cDNA ORF Clone, Rat, N-HA tag
SPD-02738
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Rat Cd28 molecule with N terminal HA tag. |
Target Information | |
---|---|
Species | Rat |
Target Name | CD28 |
Gene Abbr. | Cd28 |
Gene ID | 25660 |
Full Name | Cd28 molecule |
Alias | CD28RNA |
Introduction | CD28 is a transmembrane glycoprotein expressed by T cells as well as some other hematopoietic cells. T cell activation requires T cell receptor (TCR) recognition of antigen presented in the context of MHC molecules. CD28 acts as a T cell costimulatory receptor, and interaction of CD28 with its ligands CD80 or CD86 provides the second signal required for naïve T cell activation. Activation of naïve T cells in the absence of CD28 stimulation can result in a state of T cell anergy, or unresponsiveness. CD28 signals through cytoplasmic phospho-tyrosine motifs that bind several SH2 or SH3 domain-containing proteins involved in T cell activation. Recently, CD28 was demonstrated to be a preferred target of PD-1-mediated dephosphorylation. Consistently, CD28 expression was required for T cell proliferation following PD-1 blockade and CD28 stimulation was required for effective anti-PD-1 cancer immunotherapy in mice. Several CD28 isoforms are produced by alternative splicing. |
Product Details | |
---|---|
Description | Full length Clone DNA of Rat Cd28 molecule with N terminal HA tag. |
NCBI Ref Seq | NM_013121.1 |
RefSeq ORF Size | 657 bp |
Vector | pCMV3-SP-N-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.