CD28 cDNA ORF Clone, Cynomolgus, C-His tag - CD BioSciences

service-banner

CD28 cDNA ORF Clone, Cynomolgus, C-His tag

CD28 cDNA ORF Clone, Cynomolgus, C-His tag

SPD-02751

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Cynomolgus CD28 molecule with C terminal His tag.
Target Information
Species Cynomolgus
Target Name CD28
Gene Abbr. CD28
Gene ID 102146670
Full Name CD28 molecule
Introduction CD28 is a transmembrane glycoprotein expressed by T cells as well as some other hematopoietic cells. T cell activation requires T cell receptor (TCR) recognition of antigen presented in the context of MHC molecules. CD28 acts as a T cell costimulatory receptor, and interaction of CD28 with its ligands CD80 or CD86 provides the second signal required for naïve T cell activation. Activation of naïve T cells in the absence of CD28 stimulation can result in a state of T cell anergy, or unresponsiveness. CD28 signals through cytoplasmic phospho-tyrosine motifs that bind several SH2 or SH3 domain-containing proteins involved in T cell activation. Recently, CD28 was demonstrated to be a preferred target of PD-1-mediated dephosphorylation. Consistently, CD28 expression was required for T cell proliferation following PD-1 blockade and CD28 stimulation was required for effective anti-PD-1 cancer immunotherapy in mice. Several CD28 isoforms are produced by alternative splicing.
Product Details
Description Full length Clone DNA of Cynomolgus CD28 molecule with C terminal His tag.
NCBI Ref Seq NM_001287333.1
RefSeq ORF Size 663 bp
Vector pCMV3-C-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.