CD19 cDNA ORF Clone, Human, N-FLAG tag - CD BioSciences

service-banner

CD19 cDNA ORF Clone, Human, N-FLAG tag

CD19 cDNA ORF Clone, Human, N-FLAG tag

SPD-02685

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human CD19 molecule with N terminal Flag tag.
Target Information
Species Human
Target Name CD19
Gene Abbr. CD19
Gene ID 930
Full Name CD19 molecule
Alias B4, CVID3
Introduction CD19 is a 95 kDa coreceptor, which amplifies the signaling cascade in B cells. On the B cell surface, CD19 associates with CD21, CD81 and Leu-13 to exert its function. The cytoplasmic tail of CD19 has nine conserved tyrosine residues playing critical roles in CD19 mediated function by coupling signaling molecules to the receptor. After B cell receptor or CD19 ligation, Tyr531 and Tyr500 of CD19 are progressively phosphorylated. This phosphorylation enables the coupling of PI3 kinase and Src family tyrosine kinase to CD19 and activates the PI3K and Src signaling pathways. Coligation of B cell receptor and CD19 also promotes Tyr409 phosphorylation in CD19. The phosphorylation at these sites enables its binding to Vav and mediates elevated intracellular calcium response, as well as the JNK pathway.
Product Details
Description Full length Clone DNA of Human CD19 molecule with N terminal Flag tag.
NCBI Ref Seq BC006338
RefSeq ORF Size 1671 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-SP-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites HindIII + XbaI (6kb + 1.7kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.