Online Inquiry
CD19 cDNA ORF Clone, Cynomolgus, N-Myc tag
SPD-02677
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Cynomolgus CD19 molecule with N terminal Myc tag. |
Target Information | |
---|---|
Species | Cynomolgus |
Target Name | CD19 |
Gene Abbr. | CD19 |
Gene ID | 102145514 |
Full Name | CD19 molecule |
Introduction | CD19 is a 95 kDa coreceptor, which amplifies the signaling cascade in B cells. On the B cell surface, CD19 associates with CD21, CD81 and Leu-13 to exert its function. The cytoplasmic tail of CD19 has nine conserved tyrosine residues playing critical roles in CD19 mediated function by coupling signaling molecules to the receptor. After B cell receptor or CD19 ligation, Tyr531 and Tyr500 of CD19 are progressively phosphorylated. This phosphorylation enables the coupling of PI3 kinase and Src family tyrosine kinase to CD19 and activates the PI3K and Src signaling pathways. Coligation of B cell receptor and CD19 also promotes Tyr409 phosphorylation in CD19. The phosphorylation at these sites enables its binding to Vav and mediates elevated intracellular calcium response, as well as the JNK pathway. |
Product Details | |
---|---|
Description | Full length Clone DNA of Cynomolgus CD19 molecule with N terminal Myc tag. |
NCBI Ref Seq | XM_005591542.1 |
RefSeq ORF Size | 1674 bp |
Vector | pCMV3-SP-N-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.