CD14 cDNA ORF Clone, Rhesus, untagged - CD BioSciences

service-banner

CD14 cDNA ORF Clone, Rhesus, untagged

CD14 cDNA ORF Clone, Rhesus, untagged

SPD-02619

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rhesus CD14 molecule.
Target Information
Species Rhesus
Target Name CD14
Gene Abbr. CD14
Gene ID 697482
Full Name CD14 molecule
Introduction CD14 is a leucine-rich repeat-containing pattern recognition receptor with expression largely restricted to the monocyte/macrophage cell lineage. Research studies have shown that CD14 is a bacterial lipopolysaccharide (LPS) binding glycoprotein, expressed as either a GPI-linked membrane protein or a soluble plasma protein. LPS induces an upregulation of GPI-linked CD14 expression, which facilitates TLR4 signaling and macrophage activation in response to bacterial infection.
Product Details
Description Full length Clone DNA of Rhesus CD14 molecule.
NCBI Ref Seq NM_001130433.1
RefSeq ORF Size 1128 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.