Cd14 cDNA ORF Clone, Mouse, N-HA tag - CD BioSciences

service-banner

Cd14 cDNA ORF Clone, Mouse, N-HA tag

Cd14 cDNA ORF Clone, Mouse, N-HA tag

SPD-02638

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse CD14 antigen with N terminal HA tag.
Target Information
Species Mouse
Target Name CD14
Gene Abbr. Cd14
Gene ID 12475
Full Name CD14 antigen
Introduction CD14 is a leucine-rich repeat-containing pattern recognition receptor with expression largely restricted to the monocyte/macrophage cell lineage. Research studies have shown that CD14 is a bacterial lipopolysaccharide (LPS) binding glycoprotein, expressed as either a GPI-linked membrane protein or a soluble plasma protein. LPS induces an upregulation of GPI-linked CD14 expression, which facilitates TLR4 signaling and macrophage activation in response to bacterial infection.
Product Details
Description Full length Clone DNA of Mouse CD14 antigen with N terminal HA tag.
NCBI Ref Seq NM_009841.3
RefSeq ORF Size 1146 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 582G/A not causing the amino acid variation.
Vector pCMV3-SP-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Restriction Sites KpnI + XbaI (6kb + 1.15kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.