Online Inquiry
Cd14 cDNA ORF Clone, Mouse, C-FLAG tag
SPD-02630
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse CD14 antigen with C terminal Flag tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | CD14 |
Gene Abbr. | Cd14 |
Gene ID | 12475 |
Full Name | CD14 antigen |
Introduction | CD14 is a leucine-rich repeat-containing pattern recognition receptor with expression largely restricted to the monocyte/macrophage cell lineage. Research studies have shown that CD14 is a bacterial lipopolysaccharide (LPS) binding glycoprotein, expressed as either a GPI-linked membrane protein or a soluble plasma protein. LPS induces an upregulation of GPI-linked CD14 expression, which facilitates TLR4 signaling and macrophage activation in response to bacterial infection. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse CD14 antigen with C terminal Flag tag. |
NCBI Ref Seq | NM_009841.3 |
RefSeq ORF Size | 1101 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 534G/A not causing the amino acid variation. |
Vector | pCMV3-C-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Restriction Sites | HindIII + XbaI (6kb + 1.14kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.