Online Inquiry
CCT2 cDNA ORF Clone, Rhesus, N-His tag
SPD-02575
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Rhesus chaperonin containing TCP1, subunit 2 (beta) with N terminal His tag. |
| Target Information | |
|---|---|
| Species | Rhesus |
| Target Name | CCT2 |
| Gene Abbr. | CCT2 |
| Gene ID | 717182 |
| Full Name | chaperonin containing TCP1 subunit 2 |
| Introduction | CCT2 is one of eight largely unrelated subunit proteins found in a protein chaperone complex known as the chaperonin-containing TCP-1 (CCT) or TRiC complex. The CCT complex is an abundanct cytoslic component that is credited with helping newly synthesized polypeptides adopt the correct conformation. Proteins that fold and assemble with the help of CCT include the cytoskeletal proteins actin and tubulin as well as up to 15% of newly synthesized eukaryotic proteins. CCT2 is the β-subunit of the chaperone complex and is one of several CCT proteins that exhibit increased expression in response to stress. This implies that the CCT complex helps cells recover from protein damage by assisting in protein folding and assembly. CCT subunit levels also change throughout the cell cycle, with lower proteins levels (and reduced chaperone activity) found during induced cell cycle arrest during at M phase. Each CCT subunit is thought to perform a specific function during protein folding and assembly; CCT2 exhibits both actin and tubulin binding activities (6,3) but the exact molecular function on this subunit remains uncertain. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Rhesus chaperonin containing TCP1, subunit 2 (beta) with N terminal His tag. |
| NCBI Ref Seq | NM_001261311.1 |
| RefSeq ORF Size | 1608 bp |
| Vector | pCMV3-N-His |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.