Ccr5 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Ccr5 cDNA ORF Clone, Mouse, untagged

Ccr5 cDNA ORF Clone, Mouse, untagged

SPD-02548

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse chemokine (C-C motif) receptor 5.
Target Information
Species Mouse
Target Name CCR5
Gene Abbr. Ccr5
Gene ID 12774
Full Name chemokine (C-C motif) receptor 5
Alias AM4-7, CD195, Cmkbr, Cmkbr5
Introduction CCR5 is a G protein-linked seven transmembrane domain chemokine receptor. CCR5 serves as a receptor for several chemokines including MIP-1 alpha, MIP-1 beta, MCP-2, and RANTES. It also functions as a coreceptor for Macrophage Tropic HIV-1 infection.
Product Details
Description Full length Clone DNA of Mouse chemokine (C-C motif) receptor 5.
NCBI Ref Seq NM_009917.5
RefSeq ORF Size 1065 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 1.07kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.