Ccr2 cDNA ORF Clone, Rat, C-FLAG tag - CD BioSciences

service-banner

Ccr2 cDNA ORF Clone, Rat, C-FLAG tag

Ccr2 cDNA ORF Clone, Rat, C-FLAG tag

SPD-02489

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat chemokine (C-C motif) with C terminal Flag tag.
Target Information
Species Rat
Target Name CCR2
Gene Abbr. Ccr2
Gene ID 60463
Full Name C-C motif chemokine receptor 2
Introduction CCR2, or C-C chemokine receptor type 2, is a receptor for several monocyte chemo attractant proteins (MCP1, MCP3, MCP4) which specifically mediate monocyte chemotaxis. CCR2 transduces such signals by increasing the intracellular level of calcium ions. For example, MCP1 is involved in monocyte infiltration in inflammatory diseases such as rheumatoid arthritis as well as in the inflammatory response against tumors. CCR2 is also an alternative coreceptor with CD4 for HIV1 infection. CCR2 has two isoforms and has been reported to be expressed in a wide variety of tissues, including blood, brain, heart, kidney, liver, lung, ovary, pancreas, spinal cord, spleen and thymus.
Product Details
Description Full length Clone DNA of Rat chemokine (C-C motif) with C terminal Flag tag.
NCBI Ref Seq NM_021866.1
RefSeq ORF Size 1365 bp
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.