Online Inquiry
CCR1 cDNA ORF Clone, Rhesus, untagged
SPD-02475
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Rhesus chemokine (C-C motif) receptor 1. |
| Target Information | |
|---|---|
| Species | Rhesus |
| Target Name | CCR1 |
| Gene Abbr. | CCR1 |
| Gene ID | 574188 |
| Full Name | C-C motif chemokine receptor 1 |
| Introduction | CCR1, a Chemokine Receptor, affects stem cell proliferation and mediates systemic inflammatory responses. This receptor is stimulated by the beta chemokines RANTES, MCP-1, and MIP-1 alpha. Disruption of CCR1 enhances protection from pulmonary inflammation and reduces the development of respiratory distress syndrome in rat. CCR1 is widely expressed, particularly in hematopoietic cells from blood, vessels, and bone marrow. This receptor has also been reported to be expressed in lung, brain, placenta, heart, skeletal muscle, and kidney. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Rhesus chemokine (C-C motif) receptor 1. |
| NCBI Ref Seq | NM_001032858.1 |
| RefSeq ORF Size | 1068 bp |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.