Ccr1 cDNA ORF Clone, Rat, untagged - CD BioSciences

service-banner

Ccr1 cDNA ORF Clone, Rat, untagged

Ccr1 cDNA ORF Clone, Rat, untagged

SPD-02485

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat chemokine (C-C motif) receptor 1.
Target Information
Species Rat
Target Name CCR1
Gene Abbr. Ccr1
Gene ID 57301
Full Name C-C motif chemokine receptor 1
Introduction CCR1, a Chemokine Receptor, affects stem cell proliferation and mediates systemic inflammatory responses. This receptor is stimulated by the beta chemokines RANTES, MCP-1, and MIP-1 alpha. Disruption of CCR1 enhances protection from pulmonary inflammation and reduces the development of respiratory distress syndrome in rat. CCR1 is widely expressed, particularly in hematopoietic cells from blood, vessels, and bone marrow. This receptor has also been reported to be expressed in lung, brain, placenta, heart, skeletal muscle, and kidney.
Product Details
Description Full length Clone DNA of Rat chemokine (C-C motif) receptor 1.
NCBI Ref Seq NM_020542.2
RefSeq ORF Size 1068 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.