Ccne1 cDNA ORF Clone, Mouse, C-His tag - CD BioSciences

service-banner

Ccne1 cDNA ORF Clone, Mouse, C-His tag

Ccne1 cDNA ORF Clone, Mouse, C-His tag

SPD-04373

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse cyclin E1 with C terminal His tag.
Target Information
Species Mouse
Target Name Cyclin E1
Gene Abbr. Ccne1
Gene ID 12447
Full Name cyclin E1
Alias AW538188, CycE1
Introduction Cyclin E1 and cyclin E2 can associate with and activate CDK2. Upon DNA damage, upregulation/activation of the CDK inhibitors p21 Waf1/Cip1 and p27 Kip1 prevent cyclin E/CDK2 activation, resulting in G1/S arrest. When conditions are favorable for cell cycle progression, cyclin D/CDK4/6 phosphorylates Rb and is thought to reduce the activity of p21 Waf1/Cip1 and p27 Kip1, allowing subsequent activation of cyclin E/CDK2. Cyclin E/CDK2 further phosphorylates Rb to allow progression into S-phase, where cyclin E/CDK2 is thought to phosphorylate and activate multiple proteins involved in DNA synthesis. Turnover of cyclin E is largely controlled by phosphorylation that results in SCFFbw7-mediated ubiquitination and proteasome-dependent degradation. Cyclin E1 is phosphorylated at multiple sites in vivo including Thr62, Ser88, Ser72, Thr380 and Ser384, and is controlled by at least two kinases, CDK2 and GSK-3.
Product Details
Description Full length Clone DNA of Mouse cyclin E1 with C terminal His tag.
NCBI Ref Seq NM_007633.2
RefSeq ORF Size 1227 bp
Vector pCMV3-C-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.