Online Inquiry
CCNE1 cDNA ORF Clone, Human, N-His tag
SPD-04388
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human cyclin E1 with N terminal His tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Cyclin E1 |
| Gene Abbr. | CCNE1 |
| Gene ID | 898 |
| Full Name | cyclin E1 |
| Alias | CCNE, pCCNE1 |
| Introduction | Cyclin E1 and cyclin E2 can associate with and activate CDK2. Upon DNA damage, upregulation/activation of the CDK inhibitors p21 Waf1/Cip1 and p27 Kip1 prevent cyclin E/CDK2 activation, resulting in G1/S arrest. When conditions are favorable for cell cycle progression, cyclin D/CDK4/6 phosphorylates Rb and is thought to reduce the activity of p21 Waf1/Cip1 and p27 Kip1, allowing subsequent activation of cyclin E/CDK2. Cyclin E/CDK2 further phosphorylates Rb to allow progression into S-phase, where cyclin E/CDK2 is thought to phosphorylate and activate multiple proteins involved in DNA synthesis. Turnover of cyclin E is largely controlled by phosphorylation that results in SCFFbw7-mediated ubiquitination and proteasome-dependent degradation. Cyclin E1 is phosphorylated at multiple sites in vivo including Thr62, Ser88, Ser72, Thr380 and Ser384, and is controlled by at least two kinases, CDK2 and GSK-3. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human cyclin E1 with N terminal His tag. |
| NCBI Ref Seq | NM_001238.1 |
| RefSeq ORF Size | 1233 bp |
| Vector | pCMV3-N-His |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.