Online Inquiry
CCND2 Knockout Cell Line
SPL-00841
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
2bp insertion |
Target Information | |
---|---|
Target Name | Cyclin D2 |
Gene Abbr. | CCND2 |
Gene ID | 894 |
Full Name | cyclin D2 |
Alias | KIAK0002, MPPH3 |
Species | Human |
Genomic Locus | chr12:4274201 |
Transcript | NM_001759 |
WT Expression Level | 1.75 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with CDK4 or CDK6 and functions as a regulatory subunit of the complex, whose activity is required for cell cycle G1/S transition. This protein has been shown to interact with and be involved in the phosphorylation of tumor suppressor protein Rb. Knockout studies of the homologous gene in mouse suggest the essential roles of this gene in ovarian granulosa and germ cell proliferation. High level expression of this gene was observed in ovarian and testicular tumors. Mutations in this gene are associated with megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 3 (MPPH3). [provided by RefSeq, Sep 2014]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp insertion in a coding exon of CCND2. |
Description | 2bp insertion |
Parental Cell Line | C631 |
Guide RNA Sequence | GGCCACCATTCTGCGCATGT |
PCR Primer |
Forward: CTATTTAGCCAAAGGAAGGAGGTCA Reverse: TCTGGAGAGGAACAGAAATAAAGCC |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.