Online Inquiry
CCND1 Knockout Cell Line
SPL-00839
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 176bp insertion |
| Target Information | |
|---|---|
| Target Name | Cyclin D1 |
| Gene Abbr. | CCND1 |
| Gene ID | 595 |
| Full Name | cyclin D1 |
| Alias | BCL1, D11S287E, PRAD1, U21B31 |
| Species | Human |
| Genomic Locus | chr11:69641435 |
| Transcript | NM_053056 |
| WT Expression Level | 0.23 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance throughout the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK4 or CDK6, whose activity is required for cell cycle G1/S transition. This protein has been shown to interact with tumor suppressor protein Rb and the expression of this gene is regulated positively by Rb. Mutations, amplification and overexpression of this gene, which alters cell cycle progression, are observed frequently in a variety of tumors and may contribute to tumorigenesis. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 176bp insertion in a coding exon of CCND1. |
| Description | 176bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | ACATTTGAAGTAGGACACCG |
| PCR Primer |
Forward: GTTTTGTTGAAGTTGCAAAGTCCTG Reverse: AAAATACGGATCCCTAGAAACACCA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.