Ccnd1 cDNA ORF Clone, Mouse, C-HA tag - CD BioSciences

service-banner

Ccnd1 cDNA ORF Clone, Mouse, C-HA tag

Ccnd1 cDNA ORF Clone, Mouse, C-HA tag

SPD-04355

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse cyclin D1 with C terminal HA tag.
Target Information
Species Mouse
Target Name Cyclin D1
Gene Abbr. Ccnd1
Gene ID 12443
Full Name cyclin D1
Alias AI327039, CycD1, Cyl-, Cyl-1, PR
Introduction Activity of the cyclin-dependent kinases CDK4 and CDK6 is regulated by T-loop phosphorylation, by the abundance of their cyclin partners (the D-type cyclins), and by association with CDK inhibitors of the Cip/Kip or INK family of proteins. The inactive ternary complex of cyclin D/CDK4 and p27 Kip1 requires extracellular mitogenic stimuli for the release and degradation of p27 concomitant with a rise in cyclin D levels to affect progression through the restriction point and Rb-dependent entry into S-phase. The active complex of cyclin D/CDK4 targets the retinoblastoma protein for phosphorylation, allowing the release of E2F transcription factors that activate G1/S-phase gene expression. Levels of cyclin D protein drop upon withdrawal of growth factors through downregulation of protein expression and phosphorylation-dependent degradation.
Product Details
Description Full length Clone DNA of Mouse cyclin D1 with C terminal HA tag.
NCBI Ref Seq NM_007631.2
RefSeq ORF Size 888 bp
Vector pCMV3-C-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.