Online Inquiry
CCND1 cDNA ORF Clone, Human, C-FLAG tag
SPD-04362
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human cyclin D1 with C terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | Cyclin D1 |
Gene Abbr. | CCND1 |
Gene ID | 595 |
Full Name | cyclin D1 |
Alias | BCL1, D11S287E, PRAD1, U21B31 |
Introduction | Activity of the cyclin-dependent kinases CDK4 and CDK6 is regulated by T-loop phosphorylation, by the abundance of their cyclin partners (the D-type cyclins), and by association with CDK inhibitors of the Cip/Kip or INK family of proteins. The inactive ternary complex of cyclin D/CDK4 and p27 Kip1 requires extracellular mitogenic stimuli for the release and degradation of p27 concomitant with a rise in cyclin D levels to affect progression through the restriction point and Rb-dependent entry into S-phase. The active complex of cyclin D/CDK4 targets the retinoblastoma protein for phosphorylation, allowing the release of E2F transcription factors that activate G1/S-phase gene expression. Levels of cyclin D protein drop upon withdrawal of growth factors through downregulation of protein expression and phosphorylation-dependent degradation. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human cyclin D1 with C terminal Flag tag. |
NCBI Ref Seq | NM_053056.2 |
RefSeq ORF Size | 888 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-C-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Restriction Sites | KpnI + XbaI (6kb + 0.93kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.