CCNB1 Knockout Cell Line - CD BioSciences

service-banner

CCNB1 Knockout Cell Line

CCNB1 Knockout Cell Line

SPL-00837

Size Price
1 Unit Online Inquiry
Description
1bp insertion
Target Information
Target Name Cyclin B1
Gene Abbr. CCNB1
Gene ID 891
Full Name cyclin B1
Alias CCNB
Species Human
Genomic Locus chr5:69168226
Transcript NM_031966
WT Expression Level 444.14 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is a regulatory protein involved in mitosis. The gene product complexes with p34(cdc2) to form the maturation-promoting factor (MPF). Two alternative transcripts have been found, a constitutively expressed transcript and a cell cycle-regulated transcript, that is expressed predominantly during G2/M phase. The different transcripts result from the use of alternate transcription initiation sites. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of CCNB1.
Description 1bp insertion
Parental Cell Line C631
Guide RNA Sequence TCTTGAAAAGGTACCTATGC
PCR Primer Forward: AGAAGGTAACTCTCTTCCTGACCTA
Reverse: GAATGCTCTTGCATGTATCAGTGAA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.

We use cookies to understand how you use our site and to improve the overall user experience. This includes personalizing content and advertising. Read our Privacy Policy

Accept Cookies
x