Online Inquiry
Ccnb1 cDNA ORF Clone, Rat, N-Myc tag
SPD-04337
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Rat cyclin B1 with N terminal Myc tag. |
Target Information | |
---|---|
Species | Rat |
Target Name | Cyclin B1 |
Gene Abbr. | Ccnb1 |
Gene ID | 25203 |
Full Name | cyclin B1 |
Introduction | Cyclins are a family of proteins that activate specific cyclin-dependent kinases required for progression through the cell cycle. The entry of all eukaryotic cells into mitosis is regulated by activation of cdc2/cdk1 at the G2/M transition. This activation is a multi-step process that begins with the binding of the regulatory subunit, cyclin B1, to cdc2/cdk1 to form the mitosis-promoting factor (MPF). MPF remains in the inactive state until phosphorylation of cdc2/cdk1 at Thr161 by cdk activating kinase (CAK) and dephosphorylation of cdc2/cdk1 at Thr14/Tyr15 by cdc25C. Five cyclin B1 phosphorylation sites (Ser116, 126, 128, 133, and 147) are located in the cytoplasmic retention signal (CRS) domain and are thought to regulate the translocation of cyclin B1 to the nucleus at the G2/M checkpoint, promoting nuclear accumulation and initiation of mitosis. While MPF itself can phosphorylate Ser126 and Ser128, polo-like kinase 1 (PLK1) phosphorylates cyclin B1 preferentially at Ser133 and possibly at Ser147. At the end of mitosis, cyclin B1 is targeted for degradation by the anaphase-promoting complex (APC), allowing for cell cycle progression. Research studies have shown that cyclin B1 is overexpressed in breast, prostate, and non-small cell lung cancers. |
Product Details | |
---|---|
Description | Full length Clone DNA of Rat cyclin B1 with N terminal Myc tag. |
NCBI Ref Seq | NM_171991.2 |
RefSeq ORF Size | 1272 bp |
Vector | pCMV3-N-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.