Ccnb1 cDNA ORF Clone, Rat, N-Myc tag - CD BioSciences

service-banner

Ccnb1 cDNA ORF Clone, Rat, N-Myc tag

Ccnb1 cDNA ORF Clone, Rat, N-Myc tag

SPD-04337

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat cyclin B1 with N terminal Myc tag.
Target Information
Species Rat
Target Name Cyclin B1
Gene Abbr. Ccnb1
Gene ID 25203
Full Name cyclin B1
Introduction Cyclins are a family of proteins that activate specific cyclin-dependent kinases required for progression through the cell cycle. The entry of all eukaryotic cells into mitosis is regulated by activation of cdc2/cdk1 at the G2/M transition. This activation is a multi-step process that begins with the binding of the regulatory subunit, cyclin B1, to cdc2/cdk1 to form the mitosis-promoting factor (MPF). MPF remains in the inactive state until phosphorylation of cdc2/cdk1 at Thr161 by cdk activating kinase (CAK) and dephosphorylation of cdc2/cdk1 at Thr14/Tyr15 by cdc25C. Five cyclin B1 phosphorylation sites (Ser116, 126, 128, 133, and 147) are located in the cytoplasmic retention signal (CRS) domain and are thought to regulate the translocation of cyclin B1 to the nucleus at the G2/M checkpoint, promoting nuclear accumulation and initiation of mitosis. While MPF itself can phosphorylate Ser126 and Ser128, polo-like kinase 1 (PLK1) phosphorylates cyclin B1 preferentially at Ser133 and possibly at Ser147. At the end of mitosis, cyclin B1 is targeted for degradation by the anaphase-promoting complex (APC), allowing for cell cycle progression. Research studies have shown that cyclin B1 is overexpressed in breast, prostate, and non-small cell lung cancers.
Product Details
Description Full length Clone DNA of Rat cyclin B1 with N terminal Myc tag.
NCBI Ref Seq NM_171991.2
RefSeq ORF Size 1272 bp
Vector pCMV3-N-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.