Ccnb1 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Ccnb1 cDNA ORF Clone, Mouse, untagged

Ccnb1 cDNA ORF Clone, Mouse, untagged

SPD-04330

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse cyclin B1.
Target Information
Species Mouse
Target Name Cyclin B1
Gene Abbr. Ccnb1
Gene ID 268697
Full Name cyclin B1
Alias CycB1; Cycb-4; Cycb-5; Ccnb1-r; Ccnb1-rs1; Cycb1-rs1; Ccnb1-rs13
Introduction While overcoming the G1/S checkpoint to commence DNA replication requires cyclin E, and traversing the G2/M checkpoint to initiate mitosis requires cyclin B to be present, cyclin A seems to be required for both S-phase and M-phase. A number of studies have described the ability of over-expressed cyclin A to accelerate the G1 to S transition causing DNA replication, and cyclin A antisense DNA can prevent DNA replication. Cyclin A availability is apparently the rate-limiting step for entry into mitosis, and cyclin A is required for completion of prophase. At late prophase, cyclin A may no longer be necessary as cdc2/cyclinB1 becomes active.
Product Details
Description Full length Clone DNA of Mouse cyclin B1.
NCBI Ref Seq NM_172301.3
RefSeq ORF Size 1293 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 1.29kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.