Online Inquiry
Ccnb1 cDNA ORF Clone, Mouse, N-Myc tag
SPD-04328
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse cyclin B1 with N terminal Myc tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | Cyclin B1 |
Gene Abbr. | Ccnb1 |
Gene ID | 268697 |
Full Name | cyclin B1 |
Alias | CycB1; Cycb-4; Cycb-5; Ccnb1-r; Ccnb1-rs1; Cycb1-rs1; Ccnb1-rs13 |
Introduction | While overcoming the G1/S checkpoint to commence DNA replication requires cyclin E, and traversing the G2/M checkpoint to initiate mitosis requires cyclin B to be present, cyclin A seems to be required for both S-phase and M-phase. A number of studies have described the ability of over-expressed cyclin A to accelerate the G1 to S transition causing DNA replication, and cyclin A antisense DNA can prevent DNA replication. Cyclin A availability is apparently the rate-limiting step for entry into mitosis, and cyclin A is required for completion of prophase. At late prophase, cyclin A may no longer be necessary as cdc2/cyclinB1 becomes active. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse cyclin B1 with N terminal Myc tag. |
NCBI Ref Seq | NM_172301.3 |
RefSeq ORF Size | 1338 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-N-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Restriction Sites | KpnI + XbaI (6kb + 1.34kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.