Online Inquiry
Ccna2 cDNA ORF Clone, Mouse, C-FLAG tag
SPD-04301
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse cyclin A2 with C terminal Flag tag. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | Cyclin A2 |
| Gene Abbr. | Ccna2 |
| Gene ID | 12428 |
| Full Name | cyclin A2 |
| Alias | AA408589, Cc, Ccn, Ccn-, Ccn-1 |
| Introduction | While overcoming the G1/S checkpoint to commence DNA replication requires cyclin E, and traversing the G2/M checkpoint to initiate mitosis requires cyclin B to be present, cyclin A seems to be required for both S-phase and M-phase. A number of studies have described the ability of over-expressed cyclin A to accelerate the G1 to S transition causing DNA replication, and cyclin A antisense DNA can prevent DNA replication. Cyclin A availability is apparently the rate-limiting step for entry into mitosis, and cyclin A is required for completion of prophase. At late prophase, cyclin A may no longer be necessary as cdc2/cyclinB1 becomes active. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse cyclin A2 with C terminal Flag tag. |
| NCBI Ref Seq | NM_009828.2 |
| RefSeq ORF Size | 1269 bp |
| Vector | pCMV3-C-FLAG |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.