CCNA2 cDNA ORF Clone, Human, C-FLAG tag - CD BioSciences

service-banner

CCNA2 cDNA ORF Clone, Human, C-FLAG tag

CCNA2 cDNA ORF Clone, Human, C-FLAG tag

SPD-04311

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human cyclin A2 with C terminal Flag tag.
Target Information
Species Human
Target Name Cyclin A2
Gene Abbr. CCNA2
Gene ID 890
Full Name cyclin A2
Alias CCN1, CCNA
Introduction While overcoming the G1/S checkpoint to commence DNA replication requires cyclin E, and traversing the G2/M checkpoint to initiate mitosis requires cyclin B to be present, cyclin A seems to be required for both S-phase and M-phase. A number of studies have described the ability of over-expressed cyclin A to accelerate the G1 to S transition causing DNA replication, and cyclin A antisense DNA can prevent DNA replication. Cyclin A availability is apparently the rate-limiting step for entry into mitosis, and cyclin A is required for completion of prophase. At late prophase, cyclin A may no longer be necessary as cdc2/cyclinB1 becomes active.
Product Details
Description Full length Clone DNA of Human cyclin A2 with C terminal Flag tag.
NCBI Ref Seq NM_001237.3
RefSeq ORF Size 1299 bp
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.