Online Inquiry
CCN1 Knockout Cell Line
SPL-00835
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 238bp insertion |
| Target Information | |
|---|---|
| Target Name | CCN1 |
| Gene Abbr. | CCN1 |
| Gene ID | 3491 |
| Full Name | cellular communication network factor 1 |
| Alias | CYR61, GIG1, IGFBP10 |
| Species | Human |
| Genomic Locus | chr1:85581413 |
| Transcript | NM_001554 |
| WT Expression Level | 6.79 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The secreted protein encoded by this gene is growth factor-inducible and promotes the adhesion of endothelial cells. The encoded protein interacts with several integrins and with heparan sulfate proteoglycan. This protein also plays a role in cell proliferation, differentiation, angiogenesis, apoptosis, and extracellular matrix formation. [provided by RefSeq, Sep 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 238bp insertion in a coding exon of CYR61. |
| Description | 238bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CCGACTCCCGGCGCGCACTT |
| PCR Primer |
Forward: TGGACGAGATCAGAGGCTCC Reverse: ACTTCTGGACTATGGGGACTAGTAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.