CCN1 Knockout Cell Line - CD BioSciences

service-banner

CCN1 Knockout Cell Line

CCN1 Knockout Cell Line

SPL-00834

Size Price
1 Unit Online Inquiry
Description
1bp insertion
Target Information
Target Name CCN1
Gene Abbr. CCN1
Gene ID 3491
Full Name cellular communication network factor 1
Alias CYR61, GIG1, IGFBP10
Species Human
Genomic Locus chr1:85581413
Transcript NM_001554
WT Expression Level 6.79 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The secreted protein encoded by this gene is growth factor-inducible and promotes the adhesion of endothelial cells. The encoded protein interacts with several integrins and with heparan sulfate proteoglycan. This protein also plays a role in cell proliferation, differentiation, angiogenesis, apoptosis, and extracellular matrix formation. [provided by RefSeq, Sep 2011].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of CYR61.
Description 1bp insertion
Parental Cell Line C631
Guide RNA Sequence CCGACTCCCGGCGCGCACTT
PCR Primer Forward: TGGACGAGATCAGAGGCTCC
Reverse: ACTTCTGGACTATGGGGACTAGTAT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.