Ccl7 cDNA ORF Clone, Mouse, N-His tag - CD BioSciences

service-banner

Ccl7 cDNA ORF Clone, Mouse, N-His tag

Ccl7 cDNA ORF Clone, Mouse, N-His tag

SPD-02460

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse chemokine (C-C motif) ligand 7 with N terminal His tag.
Target Information
Species Mouse
Target Name CCL7/MARC
Gene Abbr. Ccl7
Gene ID 20306
Full Name chemokine (C-C motif) ligand 7
Alias MCP-, MCP-3, Scy, Scya7, fi
Introduction This gene encodes monocyte chemotactic protein 3, a secreted chemokine which attracts macrophages during inflammation and metastasis. It is a member of the C-C subfamily of chemokines which are characterized by having two adjacent cysteine residues. The protein is an in vivo substrate of matrix metalloproteinase 2, an enzyme which degrades components of the extracellular matrix. This gene is part of a cluster of C-C chemokine family members on chromosome 17q.
Product Details
Description Full length Clone DNA of Mouse chemokine (C-C motif) ligand 7 with N terminal His tag.
NCBI Ref Seq NM_013654.3
RefSeq ORF Size 318 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-SP-N-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Restriction Sites KpnI + XbaI (6kb + 0.32kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.