Online Inquiry
CCL7 cDNA ORF Clone, Human, untagged
SPD-02464
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human chemokine (C-C motif) ligand 7. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | CCL7/MARC |
| Gene Abbr. | CCL7 |
| Gene ID | 6354 |
| Full Name | C-C motif chemokine ligand 7 |
| Alias | FIC, MARC, MCP-3, MCP3, NC28 |
| Introduction | This gene encodes monocyte chemotactic protein 3, a secreted chemokine which attracts macrophages during inflammation and metastasis. It is a member of the C-C subfamily of chemokines which are characterized by having two adjacent cysteine residues. The protein is an in vivo substrate of matrix metalloproteinase 2, an enzyme which degrades components of the extracellular matrix. This gene is part of a cluster of C-C chemokine family members on chromosome 17q. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human chemokine (C-C motif) ligand 7. |
| NCBI Ref Seq | BC112258 |
| RefSeq ORF Size | 300 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + XbaI (6.1kb + 0.3kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.