Ccl20 cDNA ORF Clone, Rat, C-Myc tag - CD BioSciences

service-banner

Ccl20 cDNA ORF Clone, Rat, C-Myc tag

Ccl20 cDNA ORF Clone, Rat, C-Myc tag

SPD-02426

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat chemokine (C-C motif) ligand 20 with C terminal Myc tag.
Target Information
Species Rat
Target Name CCL20
Gene Abbr. Ccl20
Gene ID 29538
Full Name C-C motif chemokine ligand 20
Alias ST38, Scya20
Introduction CCL20, also known as MIP-3 alpha, LARC (Liver and Activation-regulated Chemokine) and as Exodus, is one of many novel beta chemokines identified through bioinformatics. Rat CCL20 cDNA encodes a 96 amino acid (aa) precursor protein with a 25 aa putative signal peptide that is predicted to be cleaved to form the 71 aa mature secreted protein. CCL20 is distantly related to other beta chemokines (20-28% aa sequence identity). Rat MIP-3 alpha shares approximately 70 and 61% aa sequence homology with mouse and human CCL20, respectively. CCL20 has been shown to be expressed predominantly in lymph nodes, appendix, PBL, fetal liver, fetal lung, and epithelial cells of intestinal tissues. The expression of CCL20 is strongly up-regulated by inflammatory signals and down-regulated by the anti-inflammatory cytokine IL-10. Synthetic or recombinant CCL20 has been shown to be chemotactic for lymphocytes and dendritic cells, and inhibits proliferation of myeloid progenitors in colony formation assays. CCL20 has now been shown to be a unique functional ligand for CCR-6 (previously referred to as GPR-CY4, CKR-L3, or STRL22 orphan receptor), a chemokine receptor that is selectively and highly expressed in human dendritic cells derived from CD34+ cord blood precursors.
Product Details
Description Full length Clone DNA of Rat chemokine (C-C motif) ligand 20 with C terminal Myc tag.
NCBI Ref Seq NM_019233.1
RefSeq ORF Size 291 bp
Vector pCMV3-C-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.