Online Inquiry
CCL20 cDNA ORF Clone, Human, untagged
SPD-02453
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human chemokine (C-C motif) ligand 20, transcript variant 2. |
Target Information | |
---|---|
Species | Human |
Target Name | CCL20 |
Gene Abbr. | CCL20 |
Gene ID | 6364 |
Full Name | C-C motif chemokine ligand 20 |
Alias | CKb4, Exodus, LARC, MIP-3-alpha, MIP-3a |
Introduction | CCL20, also known as MIP-3 alpha, LARC (Liver and Activation-regulated Chemokine) and as Exodus, is one of many novel beta chemokines identified through bioinformatics. Rat CCL20 cDNA encodes a 96 amino acid (aa) precursor protein with a 25 aa putative signal peptide that is predicted to be cleaved to form the 71 aa mature secreted protein. CCL20 is distantly related to other beta chemokines (20-28% aa sequence identity). Rat MIP-3 alpha shares approximately 70 and 61% aa sequence homology with mouse and human CCL20, respectively. CCL20 has been shown to be expressed predominantly in lymph nodes, appendix, PBL, fetal liver, fetal lung, and epithelial cells of intestinal tissues. The expression of CCL20 is strongly up-regulated by inflammatory signals and down-regulated by the anti-inflammatory cytokine IL-10. Synthetic or recombinant CCL20 has been shown to be chemotactic for lymphocytes and dendritic cells, and inhibits proliferation of myeloid progenitors in colony formation assays. CCL20 has now been shown to be a unique functional ligand for CCR-6 (previously referred to as GPR-CY4, CKR-L3, or STRL22 orphan receptor), a chemokine receptor that is selectively and highly expressed in human dendritic cells derived from CD34+ cord blood precursors. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human chemokine (C-C motif) ligand 20, transcript variant 2. |
NCBI Ref Seq | NM_001130046.1 |
RefSeq ORF Size | 288 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-untagged |
Promoter | Enhanced CMV promoter |
Restriction Sites | KpnI + XbaI (6.1kb + 0.29kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Ampicillin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.